Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
A unique feature of the nucleus is that it disassembles and re-forms each time mostcells divide. At the beginning of mitosis, the chromosomes condense, the nucleolus disappears, and the nuclear envelope breaks down, resulting in the release of most of the contents of the nucleus into the cytoplasm.
Hope that helped
Fracking collects natural gas that forms when organic matter is compressed under great temperature and pressure.
<h3>What is natural gas?</h3>
Natural gas is a mixture of gaseous hydrocarbons associated with petroleum deposits; mostly methane with smaller amounts of ethane, propane and butane; principally used as a fuel.
Natural gas is formed by the combination of compression and high temperature causing the carbon bonds in the organic matter to break down.
Therefore, it can be said that Fracking collects natural gas that forms when organic matter is compressed under great temperature and pressure.
Learn more about natural gas at: brainly.com/question/12200462
#SPJ1
Answer and Explanation:
Cyclins and cyclin-dependent protein kinases (CDPKs, cell proteins) also function to control the cell cycle. A group of cyclins: the G1 cyclins, are synthesized during G1 phase and function to activate CDPKs which initiate DNA synthesis at the G1/S checkpoint. The cell fails to progress to S phase if there is no sufficient synthesis of G1 cyclins. After a cell passes through this point, the G1 cyclins are degraded, allowing for another group of cyclins: the M cyclins (mitotic cyclins) to be synthesized. M cyclins activate a second group of CDPKs which allow the cell to pass the G2/M control point and into mitosis.
In the G1/s check point, entrance into the S phase is blocked if the genome is damaged. In the G2/M check point, entrance into the M phase is halted if the DNA replication is incomplete. In the M phase, anaphase blocked if chromatids are not properly assembled.
