Answer:
True.
Explanation:
The earth system is itself an integrated system, but it can be subdivided into four main components, sub-systems or spheres: the geosphere, atmosphere, hydrosphere and biosphere. These components are also systems in their own right and they are tightly interconnected.
Answer:
A. the population must be very large
Hello There!
<span>Faith believes that she is the reincarnation of Cleopatra. Faith is most likely suffering from delusions of grandeur.</span>
Hope This Helps You!
Good Luck :)
- Hannah ❤
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
B. Formal operational stage of cognitive development
