As blood pressure increases and the hearts is working harder the most vulnerable arteries area are those <u>Located near the heart, because they are absorbing the most shock.</u>
<u></u>
Explanation:
When the heart pumps blood, the highest pressure is felt close to the heart. This is why the aorta, the artery that carries blood away from the heart is made up of thick walls to withstand this pressure, otherwise, these vessels would rupture. Away from the heart, this pressure lessens, and the blood vessels are not so thick-walled.
Learn More:
For more on structure of arteries check out
brainly.com/question/2700868
brainly.com/question/1686670
#LearnWithBrainly
Hazardous substances are dangerous substances while toxins are poisonous substances. Hazardous substances may cause harm to an individuals health; they include acute toxins such as cyanide; substances harmful after repeated or prolonged exposure such as mercury and silica, among others. Toxic substances can be poisonous or cause health effects.
Answer: If you break the two terms down, "intraspecific" just means within a species, while "interspecific" means between them. Consequently, interspecific competition is all about competition between two or more species, while intraspecific competition involves different individuals of the same species.
Great question
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
Mitochondria
Explanation:
Pyruvic acid enters the mitochondria where in the presence of oxygen it is converted into acetyl coenzyme A. Acetyl coenzyme A joins the Krebs cycle in which it is broken down to carbon dioxide, water and energy which is used to produce ATP. ATP is a complex organic molecule.