Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Answer:
Information that are required to classify an organism are given below.
1. Unicellular or multicellular : First we have to see that from how many cells the body of organisms formed.
2. Composition of cell wall: Secondly we have to see the cell wall composition.
3. Prokaryotic or eukaryotic cell: We have to see the nucleus of organisms, if it has nucleus we can say that it is a eukaryotic cell.
4. Mode of nutrition: Mode of nutrition means is the organisms is autotroph or heterotroph.
If they have similarities, so it is placed in one group. If not so it is placed in different group or kingdom.
What types of factors should be investigated?
D. Both abiotic and biotic factors in their ecosystem
Abiotic factors are non-living parts of an environment, while Biotic factors are the living parts of an environment. That being said, you should investigate both when the population of jellyfish show a sharp decline, in order to find out the cause in the decline of jellyfish.
Coal contains sulfur and other elements, like dangerous metals (mercury, leads, and arsenic) that get into the air when coal is burned. Burning coal releases particulates and cause an increase in air pollution, it also emits the amount of CO2 (carbon dioxide) in the atmosphere
It spreads blood and oxygen throughout your body.
