8. is more fertilizers as that is the thing ehich changes everything because without that nothing will change
9. is the colour of light or plant growth i am unsure sorry
Answer:
A. Producer Primary comsumer Secondary consumer
Photogenic traits are determined by multiple GENES received from each parent.
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Answer:
Ball A has more density.
Explanation:
Density is found using mass divided by volume. Let's say ball A has a mass of 6 grams, and ball B has a mass of 3 grams. If the volume for both is 1 mL, then ball A has more density.
