Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Yes It's Possible for a curved path to move by force
Answer:
The reproductive system.
Explanation:
Without the reproductive system, humans are not able to reproduce meaning the human species would go extinct. With the reproductive system, humans are able to create more humans, in this way humans do not go extinct.
Answer:
1- substitution.
2- neutral.
Explanation:
The change in the genetic sequence of the organisms known as mutation. Mutations might be sudden and heritable in nature. spontaneous mutation and induced mutation are types of mutation.
A change that causes a change in single base pair of a gene sequence is called substitution mutation. The original leucine sequence is GTT and the mutated sequence is GTG. Thus T has been substituted by G.
Mutation can be beneficial, detrimental or neutral. The neutral mutation is that does not affect the physical change. Both GTT and GTG code for the same amino acid so it would be neutral.
Answer:::::::::::: Meiosis………