Answer:
Explanation:
This question is incomplete. However, what is described in this question is a method of DNA damage repair mechanism. The method described is called base excision repair. Generally, glycosylases play important roles in base excision repair (as they detect and remove these damaged bases).
One thing that can be considered while identifying the bond to be broken is the codon that will be formed after the removal of base. If this codon (a three base sequence) will still produce the same protein as when a normal cytosine was present.
NOTE: During this base excision repair, a glycosylase will detect and remove the damaged cytosine. Once removed, the remaining nucleotide backbone (of the removed cytosine) is also removed and the gap is filled and sealed by other enzymes in this repair mechanism.
The patient would take a combination of atovaquone and proguanil. Both combined are effective for the treatment of c<span>hloroquine-resistant malaria.</span>
The MRI machine allowing us to see how the brain reacts to different stimuli is one.
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
I would say B). Hope this helps!
