Hello! The answer is false.
It is actually the opposite. The notochord is a primitive axial skeleton, and in humans, it disappears. It eventually becomes part of the vertebral column, which is the backbone that we have today.
Hope this helps!
Spread of disease is density dependent because it is more severe the greater the population density as the disease would spread more easily. If there is low population density it would spread slower.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
Please see below
Explanation:
I always tell people that I love to dance, to write and to paint.
The verb keep cannot take an infinitive afterwards so it is better to replace that expression altogether with another one that means the same thing, but that can use an infinitive. The verb love can take either gerunds or infinitives afterwards with only a subtle variation in the meaning.