How is a fish similar to an oak tree?

2 answers:

4 0

A fish and an oak tree are both living things that are made out of cells. They both need water and sunlight to live and they are carbon-based.

Hope this helped.

Radda [10]2 years ago

3 0

They are both living this and they are both made of cells

You might be interested in

According to water resource experts, what are the two main causes of water waste?

Tom [10]

Answer:

"low cost of water to users and lack of government subsidies for improving the efficiency of water use"

Explanation:

- low cost of water to users and lack of government subsidies for improving the efficiency of water use

The leading cause of water pollution? agriculture.

In the western United States, as compared to the eastern United States, the major water problem is chronic drought and insufficient runoff

6 0

1 year ago

It is to transport of two substrates in the same direction across the membrane.

RSB [31]

Answer:

Active transport

Explanation:

To transport the substrate across the membrane it will need energy in the process it's called active transport.

8 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

2 years ago

What elements has the same number of valence electrons as aluminum

Lera25 [3.4K]

Boron (B), Gallium (Ga), Indium (In), Thallium(Tl)

7 0

2 years ago

What are vaccines made from

murzikaleks [220]

Vaccines and shots are typically made of a small controlled portion of the virus or disease to cause immunity to the large scale types.

8 0

2 years ago

Read 2 more answers