Answer:
Explanation:
detritivores
primary producers
the lower part of the pyramid the further away from the sun the food is the more toxic it is likely to become
photosynthesis from the sun...
Answer:
The two components are often found as part of an enzyme are: Protein: proteins increase the rate of reaction that takes place within the living organism. proteins consist of one or more chains of amino acids that make macromolecules.
Explanation:
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
Separation from spiritual ties.
Explanation:
Spirituality may be defined as the belief towards the religion or the religious process that helps to find the individual identity of the man. The spirituality might also represent the Holy spirit in Christians.
The spirituality is helpful for the connection of the individual with its religion. The esoteric traditions and religious traditions are involved in the spirituality. Allen do not attend the mass implies that he might be separating from the spiritual ties and loses his belief from the religion.
Thus, the answer is separation from spiritual ties.
Answer:
Sedimentary rocks are types of rock that are formed by the accumulation or deposition of mineral or organic particles at the Earth's surface, followed by cementation. Sedimentation is the collective name for processes that cause these particles to settle in place.
Igneous rock (derived from the Latin word ignis meaning fire), or magmatic rock, is one of the three main rock types, the others being sedimentary and metamorphic. Igneous rock is formed through the cooling and solidification of magma or lava.
Metamorphic rocks were once igneous or sedimentary rocks, but have been changed (metamorphosed) as a result of intense heat and/or pressure within the Earth's crust. They are crystalline and often have a “squashed” (foliated or banded) texture.
Explanation:
