D
Because most air pollution is caused by the burning of fossil fuels burned in the home
Answer:
The correct answer is - D. natural selection.
Explanation:
Sexual selection takes place due to competition between individuals of the intraspecies same-sex and of mate choice which driving the evolution of reproductive traits.
Sexual selection is a mode of natural selection as it leads to the evolution of specific traits. Other examples or options are not related to sexual selection directly and are not affected by sexual selection.
DNA fingerprint is a pattern of dark bands on photographic film that is made when DNA fragments are separated by gel electrophoresis and tagged. The photograph produced is often used to determine whether or not suspects were involved in a crime.
hope this helps!
Answer:
Dexamethasone drug in an individual lowers the level of plasma cortisol by lowering the release of Adrenocorticotropic hormone from the anterior lobe of pituitary gland.But in case of people suffering from Cushing syndrome dose of dexamethasone does not lowers the plasma cortisol level.
Explanation:
Dexamethasone is a synthetic Glucocorticoid.As a result it"s functions will be analogous to that of Glucocorticoid.Dexamethasone generally stimulate the rate of Gluconeogenesis thus increasing the production of glucose.As a result the plasma glucose level is elevated.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand