The bacteria transform nitrogen into useful forms for the plants; the plants provide carbohydrates.
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
Yes the following statements about her trout is likely true Because the ponds are different and the populations are likely to experience different mutations, the populations will likely diverge evolutionarily, but only over many generations.
Explanation:
The effect of genetic drift can be seen in all populations but the most is seen in small population. The change in allele frequency due to the sampling error would lead to evolution of the species.
Bottleneck effect is when a population gets reduced due to some natural disaster. Her friends were not right about bottleneck effect.
So it is clear that no bottleneck effect will occur as each pond have different chance or rate of mutation and the change in alleles will be different. The trouts will evolve independently in the different ponds and pass on the traits to their progeny.
Genetic drift does not take into account for the harm or benefit of the alleles that are passed on.
Answer: Asexual
Explanation: Since only one parent is needed, asexual reproduction is more beneficial. It is a "simpler" (in terms of not needing two mates to fornicate) and causes species to reproduce at a faster rate
It's called Data
hope it helped give thanks :)
