Hyaline cartilage makes up the costal cartilage that holds the ribs to the sternum. The most prevalent form of cartilage in the body is hyaline cartilage.
<h3>What is hyaline cartilage?</h3>
On the articulating surfaces of bones, in the larynx, trachea, and bronchi, as well as on the sternal ends of the ribs, hyaline cartilage is present. It imparts a rigid yet malleable form to the constructions.
Hyaline structures are connective tissues that anchor the ribs onto the sternum. Such structures and joints are robust because collagen fibers are present, but their mobility and flexibility are constrained. To reduce friction and provide cushioning at the joint surface, articular cartilage, also known as hyaline cartilage, covers the ends of bones.
Learn more about hyaline cartilage here:
brainly.com/question/7283023
#SPJ1
I’m not sure that your choices are because it says select all that apply but I would tell the mother to stop giving the baby cows milk. The baby needs more iron which is in breast milk or formula if not she can become anemic and cows milk is not easy to digest for babies.
Answer:
<u><em>Ancestors</em></u>
Explanation:
Ancestors can be described as the persons from which a particular human being originated. In a broader perspective, it is referred to family history of a person. Scientists believe that all organisms on Earth originated from a common ancestor which were the prokaryotes. The prokaryotes with time gave rise to the eukaryotes. Common descent is the phenomenon in which organisms having common ancestors are referred.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
option c
Explanation:
Vascular plants transport water and nutrients using the vascular bundles, xylem and phloem. Xylem transports the former and phloem the latter
