Answer:
the answer to this question is choice D
Answer:
Glucose is made of six carbon atoms, six oxygen atoms, and twelve hydrogen atoms. When the plant makes the glucose molecule, it gets the carbon and oxygen atoms it needs from carbon dioxide, which it takes from the air
Answer:
That is quite a gene pool you two have
Explanation:
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer: Distance
Explanation: The amount of space between two points, measured along the actual path, which connects the two points, is called distance. The amount of space between two points, measured along the minimum path which connects them, is called displacement.
