The reason why nost scientists thought that the first true cells formed on Earth were anaerobic is being shown in the second option :B. because there was no oxygen on early Earth. Paying attention to this fact scientists discovered that first cells were prokaryotes and greatest part of them created oxygen as a toxic by-product of their own metabolism which make them understand how the planet was provided with oxygen and made a conclusion that first cells were anaerobic.
It was used till the 1960s. Hope i helped.
The set of characteristics provided by Audesirk and Audesirk are: Animals are multicellular. Animals are heterotrophic, obtaining their energy by consuming energy-releasing food substances. Animals typically reproduce sexually. Animals are made up of cells that do not have cell walls.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.