Here's a question for you.

Biology

2 answers:

Verdich [7]2 years ago

5 0

Answer:

If you have something like an endoscope except controlled remotely doctors and healthcare workers could in essence use it as a sort of reconnoissance tool for diagnosing injuries and illnesses.

Explanation:

Zina [86]2 years ago

4 0

Because the camera can fit inside the body causing for doctors, nurses, healthcare workers, etc. find out the problem or go in for a check up! hope this helped love ;)

You might be interested in

ATP is a molecule that stores __in its phosphorus bonds

vivado [14]

Adenosine triphosphates glycogen I believe

8 0

2 years ago

Why is the sequence of amino acids important to protein function?

Dmitrij [34]

B or d.... hope this helps:)

3 0

2 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

2 years ago

Approximately, how many national parks are there in the United States?

TiliK225 [7]

Answer:

Explanation:

There are actually 58, but the closest approximation here is 50

6 0

2 years ago

When a person is dehydrated, his or her iv fluids?

Lapatulllka [165]

When an individual is dehydrated, his or her intravenous fluids should be isotonic, because either a hypertonic or hypotonic IV would both cause damage to the individual’s red blood cells. Isotonic solutions are used: to increase the EXTRACELLULAR fluid volume because of blood loss, surgery, dehydration, fluid loss that has been loss extracellularly.

8 0

2 years ago