Which type(s) of cells have genetic material that is contained in a nucleus?
- <em>D</em><em>.</em><em> </em><em>Both</em><em> </em><em>plants</em><em> </em><em>and</em><em> </em><em>animal</em><em> </em><em>cells</em><em> </em>
<u>Eukaryotic cells are those cells that retain their genetic material inside the nucleus. They have well defined nucleus. Plants and animals cells are eukaryotic cells.</u><u>.</u><u>.</u><u>~</u>
Answer:
Ongoing effects include rising sea levels due to thermal expansion and melting of glaciers and ice sheets, and warming of the ocean surface, leading to increased temperature stratification. Other possible effects include large-scale changes in ocean circulation.
Explanation:
Mendelian genetics one of the fundamental laws is The Law of Independent Assortment. The law states that parental traits are passed independently from parent to child. The recessive trait, vestigial Wings, occurs in an approximate phenotypic ratio of 1.3. In monohybrid Cross of heterozygous (Rr) parents the expected phenotypic ratio correlates with the given 1:3 result therefore l can conclude that the parents are both heterogeneous (Rr) for vestigial wings. Normal Wings-R, Vestigial Wings (Parent 1) Rr* Rr (Parent 2) R*R- RR- Normal Wings (Child 1) R*r Rr- Normal WIngs (Child 2) r * R - Rr- Normal Wings (Child 3) r*r- rr Vestigial Wings (Child 4) 1 Vestigial Wings: 3 Normal Wings
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
C.90,000 mmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm
