Explanation:
Most of the cell surface receptors and glycoproteins. These glycoproteins have active sites that recognize specific signals, like hormones, that initiate secondary signaling pathways inside of the cell, in response to the external signal. This is how cells respond to environmental stimuli.
If a change in glycoproteins makes them unable to bind signaling molecules (like hormones) or makes them permanently bind these molecules, there will definitely be a defect in how the cell responds to external stimuli. The cell will be, for example, be unable to respond to insulin in case of elevated blood sugar levels as is the case with diabetics.
Learn More:
For more on glycoproteins check out;
brainly.com/question/11473349
brainly.com/question/13602455
#LearnWithBrainly
Answer:
D. It can act as an enzyme
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
I believe it’s A in the question
Answer:
Acid rain is caused by a chemical reaction that begins when compounds like sulfur dioxide and nitrogen oxides are released into the air. These substances can rise very high into the atmosphere, where they mix and react with water, oxygen, and other chemicals to form more acidic pollutants, known as acid rain.