Please post the questions
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
I'd say it's The discovery that all protists come from one common ancestor.
Explanation:
Based on some quick research, The current attempts of classification focus on grouping protists into between three and ten kingdoms, based on species’ common evolutionary ancestors.
Answer:
The correct answer is option C. "Longer beaks allow the birds to better access seeds in bird feeders".
Explanation:
Since climate change makes more difficult for "<em>Parus major</em>" birds to feed from its primary source of food in gardens, the birds are adapting to access their second source of food, which is the bird feeder. Longer beaks allow the birds to better access seeds in bird feeders, therefore, the birds are developing longer beaks in order to adapt to their new conditions.