Answer:
Both fish and bird embryos exhibit gill slits and a tail.
Explanation:
According to embryology, all vertebrates exhibit similar traits and structures at their embryonic stage. It becomes very difficult to differentiate between the embryos of a fish, and that of a bird, or embryo of a fish, and a human. These traits, however, disappear, as the case may be, as the embryo develops into an adult. For example, in the case of the embryo of a fish, and a bird, both shows gills slits at their respective embryonic stage. However, the gill slits in fish develop into gills, whereas in the case of birds, it disappears as the embryo develops into an adult.
Answer:
b. Diarthrotic
Explanation: is freely moveable, correct
Answer:
The heat will cause the enzyme to denature(deform) and the subtrate will no longer fit into the enzyme.
"Connective",
Hope this helped :)
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
