Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
yes it is :) I hope this helps:)
1. Natural selection is the best of the organisms to live past hardships and survive, leaving the weakest to die. Survival of the fittest.
2. Adaptation is an organism changing to better themselves in a certain environment.
3. These moths were adapted to blend into their surroundings, so as to not be seen by predators.
4. Because of the pollution from the city, the tree’s bark turned from a lighter shade brown to a darker shade brown.
5. A majority of the moths were a lighter gray. With the changing color bark they were seen more by predators.
6. Adaption caused the first darker moths to appear because they learned they needed to blend into the new tree bark color.
7. The change from light to dark gray was very needed for moths. It explains natural selection for those moths who did not adapt to different color gray. Adapting the new tree bark color helped moths been less seen by predators therefor keeping their species more alive.
Adenine (A) binds with Thymine (T).
<span>Guanine (G) binds with Cytosine (C).
</span>
Adenine and Guanine are purines. Thymine and Cytosine are pyrimidines.
Hope this helps !
Photon