Answer:
Which statement is true about biodiversity?
Human activity can improve, maintain, or hurt biodiversity
Explanation:
Biodiversity entails having different varieties of organism spread all over every habitat across the globe. Human activities could help biodiversity as well as reduce it drastically
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
A baker has created a new strain of yeast which contains no cytochrome c gene and no cytochrome c protein. this will affect what the yeast strain can do to obtain energy. what will this yeast strain do more of compared to a normal strain
Will this new strain of yeast obtain more or less free energy from glucose in its growing medium?
Answer: Less because cytochrome c is key to the electron transport chain.
Explanation:
The Cytochrome c is an essential component of the electron transport chain. Without this there will be no oxidation and reduction of iron atom will take place which could convert the ferrous ions to ferric ions. Thus the entire process of electron transport chain and energy production in the form of ATP will be compromised. So, there will be no production of energy in the anaerobic fermentation by yeast.
<span><span>Hi JayBo22!
Volcanic gas have water vapor, carbon dioxide and sulfur!
Fun Fact: You can find nitrogen, argon, helium, neon carbon dioxide, hydrogen, and methane.
I hope this helps;)
</span></span>
The Krebs cycle<span> occurs right after glycolysis. The substance that begins the </span>Krebs cycle<span> is a 3-carbon molecule called pyruvic </span>acid<span>. The process breaks down the pyruvic </span>acid<span> into acetyl coenzyme A, releasing one of the carbon atoms into carbon dioxide.
hope it help</span>
