Answer:
ice melting
juice freezing
paper folding
Explanation:
The difference between a physical reaction and a chemical reaction is composition. In a chemical reaction, there is a change in the composition of the substances in question; in a physical change there is a difference in the appearance, smell, or simple display of a sample of matter without a change in composition.
It would be a young puppy learns to beg for food by watching a older dog
Oil and water separate because they have different densities.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
