Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
a. Decrease water reabsorption
: decrease blood pressure.
b. Decrease peripheral resistance
: decrease blood pressure
c. Vasodilation
: decrease blood pressure
d. Decrease salt intake
: decrease blood pressure
e. Decrease blood volume
: decrease blood pressure
f. Vasoconstriction
: increase blood pressure
g. Increase peripheral resistance: increase blood pressure
h. Increase salt intake: increase blood pressure
i. Increase blood volume
: increase blood pressure
j. Increase water reabsorption: increase blood pressure
Explanation:
- Total peripheral resistance: This term refers to the resistance offered by the vascular system to the blood flow. This resistance is a result of the friction between the blood and the vessel's walls. In other words, it is the opposition of the vessels to blood flow. The total peripheral resistance is the summary of all the bloody circuit resistances in the body. Those mechanisms that induce vasoconstriction conduce to an increase in total peripheral resistance, while mechanisms that induce vasodilation provoke a decrease in total peripheral resistance.
- Blood pressure: This term refers to the strength applied by the blood against the vessel walls as it flows. This pressure is determined by the bombed blood strength and the volume as well as by the vessel size and flexibility. Blood pressure changes continuously according to the activity, temperature, diet, emotional state, among others.
- Salt ingestion causes an increase in plasmatic osmolarity, stimulates thirst, and hence, water ingestion. Sodium retains water, expanding the blood volume and causing an increase in vessel pressure.
- The antidiuretic hormone, also known as vasopressin hormone, is released by changes in serum osmolarity or blood volume. Its function is to keep homeostasis and make kidneys conserve or keep water by concentrating urine and by reducing its volume. By these actions, the antidiuretic hormone stimulates water reabsorption, according to the organism´s needs.
- Kidneys control blood pressure in many ways. If the pressure is elevated, kidneys produce the loss of salt and water, normalizing arterial pressure. But if pressure is low, kidneys conserve water.
it would be C the yolk because
oo, The Big Bang theory predicts how much of each element should have been made in the early universe, and what we see in very distant galaxies and old stars is just right. You cannot look in new stars, like the Sun, for this evidence, because they contain elements that were created in previous generations of stars.
i hope you will get some knowledge from here❣
I think the answer is A or D
