There are two hydrogen atoms in one molecule of water.
The answer is B) 2
I believe the answer to this is A.
2H2O --> 2H2 + O2
The mole H2O:mole O2 ratio is 2:1
Now determine how many moles of O2 are in 50g: 50g × 1mol/32g = 1.56 moles O2
Since 1 mole of O2 was produced for every 2 moles of H2O, we need 2×O2moles = H2O moles
2×1.56 = 3.13 moles H2O
Finally, convert moles to grams for H2O:
3.13moles × 18g/mol = 56.28 g H2O
D) 56.28
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
