Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
HbA; lowers
Explanation:
The BPG in our blood stands for Bisphosphoglyceric acid. It is known as by its name as 2,3-Bisphosphoglyceric acid. It is present in our blood in the red blood cells. It binds with more affinity towards the de-oxygenated hemoglobin as compared to the oxygenated hemoglobin.
Hemoglobin in blood delivers oxygen to our tissues moire efficiently. It is abbreviated as Hb.
Thus BPG binds more tightly towards HbA or adult hemoblobin and which lowers the affinity for oxygen.
The graph shows that the rate of photosynthesis increases with increased light intensity, other conditions being constant.
<h3>Photosynthesis and light intensity</h3>
From the graph, the rate of photosynthesis increases with an increase in light intensity.
At low light intensity, the photosynthesis rate increases with an increase in the concentration of carbon dioxide and level off at some point.
With medium light intensity, the rate of photosynthesis is about twice that of low light intensity under the same concentration of carbon dioxide. It also gradually levels off when the concentration of carbon dioxide reached a particular point.
The same trend applies to high light intensity. The rate of photosynthesis increased accordingly, much more than low and medium-intensity light.
Both light and carbon dioxide concentration can limit the rate of photosynthesis. When both factors are abundant, photosynthesis can be limited by other factors such as water, nutrient, etc.
More on light and photosynthesis can be found here: brainly.com/question/13201447
#SPJ1
Rhinoceros most closely represents three-horned triceratops
"Adequate shelter" is the one among the following choices given in the question that <span>would have the smallest impact on a populations size. The correct option among all the options that are given in the question is the fourth option or option "d". I hope that this is the answer that has come to your help.</span>