Females usually have smaller foot prints and they usually step in a pigeon toed manner with a smaller stride. However males, usually walks with a straightforward foot or quite tilted outwards. This is how to differentiate strides of men from women. Stride is defined as to walk long though extending steps. Women also walks gracefully they tend to walk femininely by swinging they hips and walking with short steps. In contrast, men's hip is quite stiffed when walking and takes longer steps when walking.
Bacteria cells, I believe so.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
The main reason why the testes are suspended within the scrotum is to provide cooler temperature for the testes and make it fertile for penetrating the egg. The Scrotum may contract or lengthen depending on the temperature of its surrounding.
Answer:
Sinh vật nhân sơ chỉ có một RNA Polymerase, trong khi sinh vật nhân chuẩn có ba (RNA Polymerase I, phiên mã rRNA; II, phiên mã mRNA; và III, phiên mã tRNA).