Because it creates ATP, or active transport against the concentration gradient.
Answer:
False
Explanation:
The sun is 1AU away from Earth, meaning that it is 92,955,807 miles away from Earth. Even if you travelled your whole life, the chances of you reaching the sun are astronomically low
Answer:
The correct answer would be Option C, Multipurpose Trees.
Explanation:
With the advancement in industries and other areas of technology, the rural areas have become so much polluted. So the sustainability of the rural areas is doubtful. The air in the rural areas have become polluted and needs measures to prevent it from harmful consequences of the industrial advancements. Along with industries, the air pollution is also added through vehicles discharge, waste disposal, etc also contribute towards the non sustainability of the rural areas. So to overcome all these problems, the best solution is to grow the multipurpose trees in the rural areas as much as possible to increase the sustainability of these areas. With the plantation of trees, the problem of pollution will be controlled and thus make these areas sustainable.
The water cycle is also referred to as the hydrologic cycle.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
