Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The given question is incomplete, the complete question is:
Raquel is having difficulty becoming pregnant, and her doctor believes it could be due to the position of her uterus. Which organ should the body of the uterus be immediately superior to in the pelvis? Multiple Choice Urinary bladder Rectum Ovary Vagina
Answer:
The correct answer is urinary bladder.
Explanation:
In the pelvis, the urinary bladder is the organ to which the body of the uterus would be immediately superior. In the pelvis or the lower abdomen, a pear-shaped hollow composition, present between the urinary bladder and the rectum is known as the uterus. The structure or the composition located superiorly lateral to the uterus body and associated with the utero-ovarian ligament is known as the ovary. The vagina and the rectum are located underneath the uterus or the uterine cavity.
Answer:
B
Explanation:
Its a poison stay away from it no matter how much it is
Answer:
Digestion, excretion and transportation of substances.
Explanation:
Chemical reactions such as breakdown of food, cleaning of blood and absorption of nutrients and digestion are the activities that our body done with the use of energy. Digestion of food needs energy for the breakdown of food with the help of several enzymes. Transportation of waste materials and other substances also needs energy. Our cells absorb nutrients with the help of energy molecules through active transport.
Answers;
Landowners are concerned that federal officials will restrict the use of private land if threatened or endangered species are found on it.
Explanation;
-The Endangered Species Act main legislation for protecting biodiversity in the United States.
-The Act has often generated controversy because its enforcement requires changes in our land use.
-Critics of the act cite a variety of current controversies, from spotted owls and
salmon in the Pacific Northwest to red-cockaded,woodpeckers and sea turtles in the
Southeast.
-They perceive a lack of balance in the statute and request a variety of
solutions.
