you see katie helped sandra with homework, which helped sandra not fail. Because katie did not let sandra fail, sandra can graudate and get a job. She can also thank katie for not letting sandra fail and go homeless.
sandra helped katie rollerblade. which has no significant impact. Who cares about rollerblading.
your answer is C
The stem of the plant should be cut at least three to four inches above the surface level.
The glass capillary should be tightly fixed with the stem.
The initial water level and the final water level should be carefully noted.
The droplets on the leaves should be observed and conclude that these drops are not from transpiration.
It’s an infectious agent that causes disease
Darwin concluded that the finches all shared a common ancestor but had developed different beak structures. The second sentence best describes as an ecosystem.
Explanation:
- When Charles Darwin traveled to the Galapagos Islands, he observed 14 distinct varieties of finches on the islands Darwin also observed that each finch variety ate a different type of food and lived in a slightly different habitat from the other finches, Darwin concluded that the finches all shared a common ancestor but had developed different beak structures. The second sentence best describes as an ecosystem.
- An ecosystem is a huge group of living organism such as plants,animals, micro-organisms in a particular area.
- An ecosystem is a community of living organisms related with the nonliving components in the environment, together interacting as a system.
- its abiotic constituents, includes minerals, climate, soil, water, sunlight, and all other nonliving elements, and its biotic constituents, consists of all its living members.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
