Explanation:
The most reactive metals are found on the left of the periodic table, in the blue column, known as the alkali metals. Their reactivity increases as we go down column (group) one. Reactive metals, when attached to less reactive metals, have the ability to prevent the less reactive metal from rusting.
Answer:
Law of Conservation of Energy
Explanation:
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
C. He shot tiny alpha particles through a piece of gold foil.
Explanation:
In the year 1911, Ernest Rutherford performed the gold foil experiment which gave a deeper perspective to the structure of an atom.
He simply collided a thin gold foil with an alpha particle which he generated from a radioactive source. He discovered that most of the alpha particles passed through the thin gold foil but a few were deflected back. His discovery led to the proposition of the nuclear model of the atom.
The temptation of listening to IU is hard. I love IU and you should listen to her songs esp lilac & biBi