Question

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? ttttagccatttacgattaatcg ttttagccatttacgattaatcg it would not bind the target dna. ttttagccatttacgattaatcg?

Answer 1

The answer is highlighted in bold: ttttagccatttacgattaatcg.

This DNA template is written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.

5' ttttagccatttacgattaatcg 3'  the direction (--->)
3' ..aatcg........................ 5'   the direction (<---)

adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).