Answer: Option D
Explanation:
The practice which has been prevailing from a long time is considered as culture.Farming is also a type of culture which is being practiced from a longer period of time in the society.
The farming is also a type of culture which was invented somewhere and started spreading from there to other places.
This practice helped mankind in providing food and resources to the people of nation.
Prophase, metaphase, anaphase, and telophase.
Answer:
B. Sequence of nucleotides in the organism's DNA
Explanation:
The genes within an organism rely on the DNA within those organisms. Different DNA create different genes.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
In prokaryotes, horizontal gene transfer (HGT), the transfer of genetic material from one organism to another organism within the same generation, is an important way to promote genetic diversity. HGT allows even distantly related species to share genes, influencing their phenotypes.
Transformation: Mode of genetic transfer in which “bare DNA” is taken up from the environment is taken up by cells
Transduction: Mode of genetic transfer in which genes are transferred by a bacteriophage to a bacterial cell
Conjugation: Mode of genetic transfer in which two cells must come in contact and genetic material is transferred to a recipient cell from a donor cell through its pili