Answer: option B) False
Explanation:
The body relies on SEVERAL sources for its energy or glucose supply.
Firstly, understand that Glucose could be supplied from the following:
Glycogenolysis (Glycogen break down induced by Glucagon)
Amino acids metabolism (once amine group is removed)
Fatty acid oxidation.
All of the pathways mentioned can directly or indirectly yeild GLUCOSE, thus making it UNNECESSARY for Carbohydrate meals to be consumed every 3 to 4 hours.
Therefore, the answer is False
The type of reaction that build proteins from amino acids are dehydration reactions
B) 100 times more acidic :)
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.