Answer:
Distance: 16m Displacement: 8m North
Explanation:
Total distance is the total amount traveled, regardless of direction. So, you would just add 12 and 4 to get a total distance of 16m. Displacement is the distance/direction from the start to the end point, regardless of which way you got there. So, to find displacement, you just subtract:
12m North - 4m South = 8m North
** I could be wrong so definitely double check this answer with a similar question**
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
<h2>A. Mercury's orbit is shorter than Earth</h2>
