Answer:
Explanation:
pros: introduction to recycling, people realise the damage, a faster creation to make solar panels
cons: killing the environment, people relying on things that cause pollution
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
The correct option is number 2. NADH is not product of light reactions of photosynthesis.
Explanation:
The light energy from the sun is captured by the pigmented molecule, chlorophyll, of the plants. This light energy is converted into chemical energy by a serious of light-dependent reactions. The main products of light-dependent reactions are the energy molecule ATP and NADPH. Oxygen is released as a by-product during photosynthesis. Hence, all the option 1,3 and 4 are produced during the light reactions except for option 2 i.e NADH.
Answer:
A
Explanation:
The pulmonary artery carries de-oxygenated blood from the right ventricle of the heart to the lungs. It is the only artery that carries de-oxygenated blood. This blood is usually from the tissues and has a lot of carbon dioxide from the cellular respiration of cells around the body. The blood is pumped to the lungs to be oxygenated and the carbon dioxide expelled.