This doesn’t give enough information
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
Emphysema ;A condition often caused by smoking,
Bronchitis ; The inflammation of bronchioles in the lungs
Asthma ; A condition in which an attack can trigger
Pneumonia ; The build up of fluid in the alveoli of the lungs
Explanation:
I hope it helps :)
The answer is K-selected.
The population size of K-selected species is fairly constant in time, unlike the population size of r-selected species. r-selected species are usually bellow carrying capacity and the population size is density independent. On the contrary, K-selected species are usually near or at carrying capacity and the population size is density dependent.
Answer:
The correct answer is <em><u>"Mechanized plows allow larger areas to be farmed by a single farmer."</u></em>
Explanation:
Mechanized plows allow large areas of land to be plowed quickly. A further benefit is that mechanized plows do not fatigue as people and animals do. Because of this, mechanized plows help contribute to the increasing size of modern farms.
