In small intestine millions of micro villi are present for greater absorbption of digested food.
The answer is (3) an increase in the proportion of offspring <span>that have favorable characteristics.
</span>In natural selection, genotype variations that will increase the chance of survival and reproduction of some organism are preserved and will be inherited. Peppered moth color variation is a good example of natural selection.<span>During the Industrial revolution, due to pollution, trees become darker in the urban area. Light-colored moths were, thus, easy prey. The dark-colored moths were able to camouflage on dark trees and avoid predators. The phenomenon is known as industrial melanism. So, in polluted urban areas, the number of dark-colored peppered moths increased. In the clean environment, were much effective in hiding from predators and they outnumbered the dark-colored moths.
Therefore, the </span>proportion of offspring <span>that have favorable characteristics in such environment will increase.</span>
Answer: b. reaction 3
Explanation: When an enzyme is present in a reaction acts as a catalyst, increasing velocity of reaction and decreasing the activation energy, when not present an enzyme the reaction velocity is very low and implies high activation energy, being unfavorable to the system
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
