Rodenticide because it has the word "rodent" meaning, a mammal of the order Rodentia, which mice and rats are included in. Therefore, the answer is rodenticide.
Answer:atom
Explanation:because it is defined as the smallest form of any given elemental item
Prokaryotic cells would be plant cells
eukaryotic cells would be human/animal cells
The correct answer should be Carrying capacity
Carrying capacity is the the number of people, animals, and other life forms, that an ecosystem can sustain without starting to degrade, and all these upsets can destroy it because it can cause people and animals to migrate somewhere or they can destroy the carrying capacity of the already existing one.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
