Rocks are identified primarily by the minerals they contain and by their texture. Each type of rock has a distinctive set of minerals. A rock may be made of grains of all one mineral type, such as quartzite. Much more commonly, rocks are made of a mixture of different minerals. Texture is a description of the size, shape, and arrangement of mineral grains. Are the two samples in figure 2 the same rock type? Do they have the same minerals? The same texture?
Explanation:
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
nebular hypothesis
The most widely accepted theory of planetary formation, known as the nebular hypothesis, maintains that 4.6 billion years ago, the Solar System formed from the gravitational collapse of a giant molecular cloud which was light years across. Several stars, including the Sun, formed within the collapsing cloud.
Answer:
15 chromosomes
Explanation:
The endosperm is formed through double fertilization where one male gamete nucleus with polar nuclei to form a triploid nucleus called the primary endosperm. The endosperm therefore will contain 15 chromosomes since the polar nuclei is diploid and the male gamete is haploid forming a triploid nucleus.
bones, ligaments, tendons and joints hope this helps! :)
