The nurse is required to administer vitamin k to a term newborn. how should the nurse administer this injection

1 answer:

3 0

The lateral aspect of the middle third of the vastus laterals muscle. This muscle is the preferred injection site because it is free of major blood vessels and nerves and is large enough to absorb the medication.

You might be interested in

Answer them please ty

gizmo_the_mogwai [7]

32 is 4 I’m pretty sure

6 0

2 years ago

Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:

Kryger [21]

agcgggaugagcgcauguggcgcauaacug

4 0

2 years ago

Circle the letter of the phrase that best completes the sentence.

aleksandr82 [10.1K]

Chucyiguffyihyfjgtduggufvkehoheoheibeigeigiee

6 0

2 years ago

Question 1) Explain how the structure of a cellulose molecule relates to the molecules function. Question 2) Explain how a chang

IgorC [24]

Cellulose molecules are arranged parallel to each other (flipped 180 degrees) with hydrogen bonds joining them. It forms strong cable-like structures for support. This is important as it keeps the plant straight and upright.

Changing the sequence of nucleotides in the DNA molecule can change the amino acids in the final protein, leading to protein malfunction. If insulin does not function correctly, it might be unable to bind to another protein (insulin receptor).

Adenosine triphosphate (ATP), energy-carrying molecule found in the cells of all living things. ATP captures chemical energy obtained from the breakdown of food molecules and releases it to fuel other cellular processes. ... When energy is needed by the cell, it is converted from storage molecules into ATP.

 BRAINILIEST PLEASE 

8 0

2 years ago

Which two 23.5°-latitude locations are influenced by cool surface ocean currents

77julia77 [94]

the West coast of North America and the West coast of South America

6 0

2 years ago

Read 2 more answers