Answer:
Convection process
Explanation:
The process of convection is commonly takes place in the mantle portion of the earth and also at the atmosphere.
This process is usually defined as the process where the materials are heated at a high temperature, thereby making them less denser, and due to their low density they are gradually pushed upward into the upper zones. As the materials rises up, the density gradually increases due to the lowering of the temperature, and then the materials again sinks. This give rise to the formations of a circulating cell, which are commonly known as the convection cells.
Answer: Light colored peppered moths decreases in number and dark colored peppered moths increases.
Explanation: The population of light colored peppered moths decreases whereas the dark colored peppered moths increases in number because the light colored peppered moths are visible to the predator birds whereas the dark colored peppered moths are not visible due to dark coating of the trees so they are saved from the birds and therefore, increase in population of dark colored peppered moths occurs and decrease occur in light colored peppered moths population.
In computer science, a mutator method is a method used to control changes to a variable. They are also widely known as setter methods. Often a setter is accompanied by a getter (also known as an accessor), which returns the value of the private member variable
Answer:
probably tectonic plates would shift
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.