Answer:
D.)
Explanation:
(I know this, by experience :|)
Answer:
23 chromosomes.
Explanation:
Meiosis is the process by which the chromosome number is halved during gamete formation. So chromosomes are 46 and get halved to 23 during the process of meiosis.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
<span>Due to DNA and Organelle
Duplication that takes place during Interphase within a cell, during the
splitting of a cell in Mitosis, the two daughter cells should have the exact
same genetic and physical composition as the Parent Cell. so the daughter genetic make u p is also AaSs</span>
Any flowering plant of the class Dicotyledones having two embryonic seed leaves, flower parts in fours or fives, and net-veined leaves: includes most broad-leaved flowering trees and plants.
