Leaders should employ all available active and passive surveillance measures to
identify Soldiers who may be engaging in high-risk behavior and to <span> identify Soldiers who may be at risk based on behavior and stress indicators.
</span><span>The unit commander is the critical agent for injury prevention and is responsible for establishing interventions and monitoring their effect and he/she is responsible for this.</span>
I wanna say A. Desert
Hope this helps!!
ADP has two phosphate groups and ATP has three phosphate groups but they both have phosphate groups.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
