Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Prokaryotic cells do not have membrane bound organelles and eukaryotic cells do have membrane bound organelles
In guinea pigs, rough coat (R) is dominant over smooth coat (r). Predict the genotypes and phenotypes of the offspring and give the genotypic and phenotypic ratios is a homozygous dominant guinea pig is crossed with a heterozygous guinea pig. 3. ... In humans, brown eyes (B) are dominant over blue (b).
Answer:
2(8x^2-13x+10)
Explanation:
There are 5 angle s in a pentagon and we are assuming are pentagon is a regular one so the angles are all congruent.
Let's let A represent the measurement of one of the those angles in our pentagon.
The sum of our angles in our pentagon would then be A+A+A+A+A or 5A.
But we are also given that this equals 40x^2-65x+50.
So that means 5A=40x^2-65x+50.
If we divide both sides by 5 we can find what one of our angles is in terms of x. So let's do that A=8x^2-13x+10.
So we want to know the sum of two our angles, we want to know what is A+A or 2A. 2A=2(8x^2-13x+10). To obtain that I just multiplied both sides of A=8x^2-13x+10 by 2.
Sleet
Might be wrong lol sorry if it is