Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
There are mountain ranges in the middle of the ocean floor. Because of the higher elevation gravity pushes down on the edges of the plates. This is called ridge push.
<h3><u>Explanation:</u></h3>
Ridge push is a simple explanation of the height of the landforms based on the gravity and the elasticity of the underlying rock. It says when a landform gets too much higher, the weight of the overlying rock and soil pushes the landform back to plains. Thereby an equilibrium is maintained.
Slab pull is a theory proposed which visualizes the earth interior as a pool of hot molten lava that has a convection current going on. It explains why the crust of the earth continuously moves slowly and forms mountains and other rift valleys.
Answer:
It wouldn't be able to survive
Explanation:
If the pH goes up than the coral reefs wouldn't be able to live and if they can't live there then there wouldn't be any life. There wouldn't be shelter for the fish and if there is no fish then the ecosystem would collapse.
Answer:
C
Explanation:
First off, humans are considered animals, and since animal cells don't have chloroplasts, A and D are immediately incorrect. B is incorrect because lysosomes eject enzymes that digest materials in the cell, and to heal skin, you dont need to digest anything/ use enzymes to get rid if materials. That means the answer is C. The nucleus is the control center for the cell, so it tells the cell what to do. The mitochondria creates energy for the cell, and since it takes energy to heal, this answer is correct. (Tip- I find that using process of elimination in biology questions helps a lot.) Good luck!
Answer:
VESICLES
Explanation:
Molecules of different types are produced in different compartments of a cell. These molecules, however, needs to be transported from one location to another. For this purpose, small spherical structures called VESICLES are used by the cell.
Vesicles are compartments in the cell that functions majorly as transport sacs. They help transport materials and molecules from one organnelle to another within a cell. For example, transport vesicles help in the transportation of matured proteins from the Golgi apparatus to respective locations in the cell.
