Explain that water moves down a water potential gradient, and the salt solution has a lower water potential than the vacuole so water leaves the vacuole through osmosis
In exam Q's key points are:
- Water potential gradient
- Higher water potential in vacuole
- Leaves through osmosis
Answer:
d
Explanation:
The use of fertilizers is the leading cause of eutrophication. The use of fertilizers, especially nitrate and phosphate fertilizers on farms, lawns, and golf courses, result in the accumulation of phosphate and nitrate in the nearby water body sources
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Answer:A hybrid vechicle is a cross between electric and gas and doens't use alot of the gas but more electric.
Explanation:
