Answer:
Your answer is correct based on what I remember from AP Chemistry
Explanation:
By 1.23 x 1024 you mean 10 to the power of 24 molecules? If so all you need to do is divide the number of molecules you have by Avagadros number, 6.022 x 10^23. This will give you the mols of water, or the mols of anything, since there is always 6.022 x 10^23 molecules in 1 mol of substance.
1.23x10^24 atoms/6.022x10^23 atom/mol = 2.04 mol H20
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
D, since the anther is a male organ
Answer:
Nonbonding pairs of electrons.
Explanation:
Both oxygen atoms in the diatomic molecule have two nonbonding pairs. This results in the oxygen molecule having a planar geometric shape. This is because nonbonding pairs repel each other are significant in determining the shape of a molecule.
