Hey can you please take a better picture? It’s a little blurry!
Cladodes<span> (also called cladophylls or phylloclades) are shoot systems in which leaves do not develop; rather, the stems become flattened and assume the photosynthetic </span>functions<span> of the plant. In asparagus ( Asparagus officinalis; Asparagaceae), the scales found on the asparagus spears are the true leaves.</span>
The respiratory system brings air into the lungs supplying the blood with oxygen. Oxygen is carried throughout the body to the organs and keeps the heart pumping and when the blood circulates back to the lungs the process starts over again.
The wording of this is confusing. I think it’s A and B and I’m hesitant say that it’s also C but only if you know the mutation and the gene.
Also for A you would only know a partial sequence of the gene.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: