Answer:
Explanation:
its either a) or b) i d k choose wisely please
it should be the pathgoens if you really think about it just look it up
Answer: D) Tree roots improve soil water retention
There are many reasons which states that deforestation increases the risk of flood. First , some water stay on the leaves and evaporates in to the atmosphere. Second, tree leaves reduce the impact of raindrops on the soil which causes less soil erosion.
Third, tree roots absorb water from the soil, which make the soil dry and it absorb more water rainwater. The roots of tree hold the soil in place and reduce the movement of sediment which reduce the capacity of river to break its banking. Thus, reducing the chances of flood.
<span>The best method used to prevent soil depletion would be contour farming.
In contour farming, the land is tiled in consistent elevation. Contour farming is efficient in reducing soil depletion because it can conserve rain water and reduce the erosion of soil.
If there is no contour farming in your option, then choose A. Adding fertilizer. </span>
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
